About HabAM

HabAM · ‎09-03-2019

I didn't know I could specify multiple ranges values as above. Thanks

HabAM · ‎08-14-2019

We revert the graphic template and it worked. http://support.sas.com/documentation/cdl/en/statug/68162/HTML/default/viewer.htm#statug_templt_sect008.htm

Reeza · ‎06-21-2019

You don't list the individual values, you list the variable names. Run this, changing the filepath to be relevant as a starting point and see what is generated. data _null_; set sashelp.class; file '/folders/myfolders/demo.txt' linesize=80 flowover; put Name; put Age; run; @HabAM wrote: Thank you Reeza. The only issue is I have thousands of row values to individually list as suggested. samle set ID Seq >12121 aaatatgttgactcagattggttgtactttaaattttccaattagtcctattgaaactgtaccagtaaaattgaagccag >343434 cctcaaatcactctttggcaacgacccttagttacagcaaaaataggggaacagctaatagaagccctattagacacagg >4545e cctcaaatcactctttggcaacgacccttagttacagcaaaaataggggaacagctaatagaagccctattagacacagg >1111 cctcaaatcactctttggcaacgacccttagttacagcaaaaataggggaacagctaatagaagccctattagacacagg >2321 cctcaaatcactctttggcaacgacccttagttacagcaaaaataggggaacagctaatagaagccctattagacacagg expected text file: >12121 aaatatgttgactcagattggttgtactttaaattttccaattagtcctattgaaactgtaccagtaaaattgaagccag >343434 cctcaaatcactctttggcaacgacccttagttacagcaaaaataggggaacagctaatagaagccctattagacacagg >4545e cctcaaatcactctttggcaacgacccttagttacagcaaaaataggggaacagctaatagaagccctattagacacagg >1111 cctcaaatcactctttggcaacgacccttagttacagcaaaaataggggaacagctaatagaagccctattagacacagg >2321 cctcaaatcactctttggcaacgacccttagttacagcaaaaataggggaacagctaatagaagccctattagacacagg Thank you

GraphGuy · ‎11-20-2018

Reducing the xpixels will reduce the white-space on both the left & right. Then adding an angled blank 'title2' on the right-hand side will shift some of the white space from the left to the right. (It'll take some trial-and-error.)

ShelleySessoms · ‎09-04-2018

As you'll see, your user name has now been changed. Thank for using the SAS Support Communities! Shelley

ChrisNZ · ‎08-21-2018

READ.THE.DOC. What on earth made you think that call symputx("val",Total,comma8.2); was valid syntax? The documentation shows that the third parameter cannot possibly accept formats. CALL SYMPUTX(macro-variable, value <, symbol-table>); The link you point to shows how to format values with function put().

sara_t_saspubs · ‎07-18-2018

The ODS HTML Statement documentation has information on the usage of path/body(file) under the PATH= option. Here's the link: ODS HTML Statement

hamishcarpenter · ‎06-25-2018

mehretua, Unfortunately this is not possible directly. You will need to use groovy to parse the JSON then write to a file (CSV or similar) in a way that can be read in by SAS. This is probably the best approach for large sets of data. It is possible to pass back simply key/value pairs from proc groovy into SAS by using the "exports" special variable which is used to populate SAS macro variables. This is used to pull out an OAuth token in the following example: https://blogs.sas.com/content/sascom/2013/12/12/how-to-import-twitter-tweets-in-sas-data-step-using-oauth-2-authentication-style/ /* Store bearer token in macro variable 'BEARER_TOKEN' */ proc groovy classpath="groovy-all-2.2.1.jar"; submit "&JSON_TWEET_FILE."; import groovy.json.JsonSlurper def input = new File(args[0]).text def result = new JsonSlurper().parseText(input) println "Recieved bearer token: ${result.access_token}" exports.putAt('BEARER_TOKEN',result.access_token) endsubmit; quit; It is also possible to return a comma separated list of strings using a list in groovy. See http://support.sas.com/resources/papers/proceedings17/SAS0245-2017.pdf for an example. I hope this helps. I've been exploring proc groovy on our SAS 9.4m4 linux environment. It looks suitable for pulling simple information from complex JSON. I'd be interested in seeing examples of writing more complex JSON. Hamish

HabAM · ‎06-05-2018

Thank you.. Call Execute does magic!

HabAM · ‎04-01-2018

Thanks.

HabAM · ‎02-16-2018

Thank you Cynthia

HabAM · ‎11-30-2017

Thank you

ChrisHemedinger · ‎11-30-2017

@Pranjal - what are you trying to get from this "page"? The URL you supplied is a javascript file, not XML. Please post the details of what you need in a different question, rather than add to this solved topic.

Reeza · ‎11-29-2017

Please mark the question as solved.

ChrisNZ · ‎11-12-2017

@RW9 Yes, but recursions tickle the mind more,,, 🙂

Online Status	Offline
Date Last Visited	‎09-03-2019 05:55 PM

Re: Skipping dates on Proc Sgplot

Skipping dates on Proc Sgplot

Re: Proc Freq not displaying variable name

Proc Freq not displaying variable name

Re: Creating a FASTA file from dataset

Creating a FASTA file from dataset

Re: How to remove white space and format legend in proc gmap output?

Re: How to remove white space and format legend in proc gmap output?

How to remove white space and format legend in proc gmap output?

Re: How do you change your community UserName

Re: How to remove white space and format legend in proc gmap output?

Re: Using macro stored numbers in report- symput

Re: ODS HTML error

Re: using macro in do loop

Re: ODS HTML error

Re: Skipping dates on Proc Sgplot

Re: Proc Freq not displaying variable name

Re: Creating a FASTA file from dataset

Re: How to remove white space and format legend in proc gmap output?

Re: How do you change your community UserName

Re: Using macro stored numbers in report- symput

Re: ODS HTML error

Re: Create a SAS data set from JSON file using PROC GROOVY

Re: using macro in do loop

Re: Proc Sql pass through on multiple server

Re: ODS PDF Title statement

Re: Web scraping a CDC.gov site using SAS

Re: Scrape data from a webpage

Re: Not receiving SMS messages

Re: recursive joins with PROC SQL